                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:174 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:156 nt. Size=30 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:113 nt.    Size=59 nt.     Delta G=-18.53 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-aataat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaatgtggcgacaatatgaataatcgaatcaggggcctaacaaacaccttgaatccacaagcgggtagattgccgacacaatcttttctccgcgca
ttaaaggctttgactcattatatgcgtatagcatataaatggcttgtcgggtgtagctatgccataaaatacccttaatgggaaaagcatagcgacgggc
ttgtggccgtgtttgttagcacccggcactcttttcgagtgtcattaacaaacatctaacccacaaggagtttacaATG

    BH03250 --- BH03240 --- BH03230 Gene: BH03250     GI: 49475128     BI number: BH03250     GOG: -------     Description: Anti-repressor protein Gene: BH03240     GI: 49475127     BI number: BH03240     GOG: -------     Description: Anti-repressor protein Gene: BH03230     GI: 49475126     BI number: BH03230     GOG: -------     Description: hypothetical prophage protei   a t  a t  t cg cg cg a  a t  a a  a a  a a  | a  | t  | a  | c  | cg gc ta at ta cg gc        gc        gt a  |      g  t      t  t t  |       gt        ta g  |       cg        tg t  |       at        gc g  |      g  g       ta g  |       cg        gc g  |       gc       |  c cg       a  c      |  c ta       t  g       cg gc        at        cg tg        cg       g  | tg        gt        gc cg        at        ta gc        at        gc                         tcttttcgagtgtcattaacaaacatctaacccacaaggagtttacaATG     ..................................................................................................................