Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATTTTCTTGAGGAGATTCACCATATAAAATCCATCCCGGATCGACGTTAAATACTTG
TCCATAGAGTTCGGCTTTTTGTCGAGAAACAGGACGATTTCCATTTTCATGACTAATT
AGAGTATTTTGATTAAGAGCTGATATAGCGCGCGCAGCCTCGCTCGGTGTTGCATACC
CAGCATTTTTACGTGCTATTTTAAGTCTATCTTTTGGCAAATAACTCATtcgtacattatccac
tatttttttcattcattgtgtactattttgtcttgattttaaattgtacgtaatgtactattTTG

    BH03640 --- BH03630


Gene: BH03640     GI: 49475165     BI number: BH03640     GOG: -------     Description: hypothetical prophage protein
Gene: BH03630     GI: 49475164     BI number: BH03630     GOG: -------     Description: hypothetical prophage protei


            T
          C  C
 GC        CG
A  G       GC
T  C       AT         G
A  G      C  |      T  C
T  C       GC        TA
A  G       CG        GT
 GC       G  |       TA
 TA        CG        GC
 CG        GT        GC
 GC        CG       C  C
A  |       GT        TA
 GC        AT        CG
 AT        TG        GC
                        ATTTTTACGTGCTATTTTAAGTCTATCTTTTGGCAAATAACTCATtcgtacattatccactatttttttcattcattgtgtactattttgtcttgattttaaattgtacgtaatgtactattTTG
    ..................................................................................................................