                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:37 nt. Size=37 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=43 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGATG-TATAAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGATGATTTAGCAAAAGAAAAATATAATGATGAGATTTACGGTACTTATGAAGAGCA
AAATAAATTGCGTCTTAGTGATGTCATTTAAattctaagggcgcgtgtaaaagcgccttctttaatctatcaatccc
atcaatatgaggtccgtaATG

    BH03670 --- BH03680 --- BH03690 --- BH03700 --- BH03710 Gene: BH03670     GI: 49475168     BI number: BH03670     GOG: -------     Description: Anti-repressor protein Gene: BH03680     GI: 49475169     BI number: BH03680     GOG: -------     Description: Anti-repressor protein Gene: BH03690     GI: 49475170     BI number: BH03690     GOG: -------     Description: hypothetical prophage protein Gene: BH03700     GI: 49475171     BI number: BH03700     GOG: NOG26096     Description: Phage related protein Gene: BH03710     GI: 49475172     BI number: BH03710     GOG: -------     Description: hypothetical prophage protei TA A  A A  A AT         T AT       A  T CG       C  T GC       T  A A  G      G  A G  |       Ta A  |       At AT        Gt GC       T  | T  T       Gc A  T       At T  |       Ta        ta TA        Ta       g  a CG       |  g      t  a AT        Cg       g  a TG        Tg        cg G  A       Gc        gc GT        Cg        cg CG        Gc        gc AT        Tg        gc                         ttctttaatctatcaatcccatcaatatgaggtccgtaATG     ..................................................................................................................