Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.20 kcal/mol
Antiterminator:    Distance from promoter:37 nt. Size=45 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-tatctt. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaaatgaagatatattttatatcttactgttgttgtcctttatgatcgtagaactgaagattgcgaaaaagctgaaatgaagagtcgcgctttctct
aatgtttcgttataaagaaacgtttgtttttgaatgctggttttgtttgaccaaacacgacggagaaagttATG

    purA


Gene: purA     GI: 49475179     BI number: BH03790     GOG: COG0104     Description: Adenylosuccinate synthetas


  a
g  a
t  g
a  a
a  g
 at
 gc
 tg
|  c
 cg
 gc
 at
 at
|  t
|  c
|  t
|  c       at
|  t      t  a
|  a      t  a
|  a      g  a
|  t       cg
|  g       ta
 at        ta
 at        ta
 at        gc
 gc        tg
 cg        at
 gt        at
            tgtttttgaatgctggttttgtttgaccaaacacgacggagaaagttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0104 Adenylosuccinate synthase ... can be seen here

    ..................................................................................................................