                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCCACAAATCGCATAATCCATTACCTCTTTTTAAAAAACGTGAAATGCTGGCGCCG
GGTATTCTCATTGGACCAGAAGGTGGCTTTAGTCAAGAAGAGCGAAGCTTTTTAAAAA
AACATCCTTTTGTAATTTCGATACCATTAGGTCCGCGTATTTTACGCGCCGACACTGC
AGCTGTTGCTGCTTTGGCTCTTTTGAATGCTACGATAGGGGATTGGTCAATTGATTGA
gaaatctgtaaaattattttaaacgattcctgtaaaatgatggaactaatggtaggatacaataagttATG

    gshA Gene: gshA     GI: 49475196     BI number: BH03970     GOG: COG3572     Description: Glutamate-cysteine ligas   T T  T       GT AT       T  T TA        CG GC        GC CG        AT GC        CG CG        GC |  C      T  T |  C      C  | CG       A  | TA       C  | GC        AT |  A       GT GC        CG AT        CG TG        GC             TCTTTTGAATGCTACGATAGGGGATTGGTCAATTGATTGAgaaatctgtaaaattattttaaacgattcctgtaaaatgatggaactaatggtaggatacaataagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG3572 Gamma-glutamylcysteine synthetase ... can be seen here     ..................................................................................................................