                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:99 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.40 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=23 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=53 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgaca-tatatt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgacaacagatggatcttcgagtttatatttttcagattcacgccgtagcatgtaagattcagtgggtaatatttaagaaaattagagatttctatgag
atatttcatgaaggaagtctttttttgtctgcaaagagggcagagtgatttgttttatgtgctatttttttctgtagggcttgcggaaaacgcatagcag
tgcaaaaataacttcATG

    rnhB --- BH04240 --- BH04250 Gene: rnhB     GI: 49475220     BI number: BH04230     GOG: COG0164     Description: Ribonuclease HII Gene: BH04240     GI: 49475221     BI number: BH04240     GOG: COG0009     Description: hypothetical protein Gene: BH04250     GI: 49475222     BI number: BH04250     GOG: COG0277     Description: Oxidoreductas ta a  t gt at gc ta at |  g |  a |  a tg cg ta                  tg ta                 g  a tg                  at at                  gt gc         a        at at       a  a       cg gt       c  g       gt at       g  a       gt t  t       tg        gt t  t       cg        at at        tg       g  a at        gc       a  t a  g       ta       a  g at        tg        at gc        ta        cg at        tg        gc                         tatttttttctgtagggcttgcggaaaacgcatagcagtgcaaaaataacttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0164 Ribonuclease HII ... can be seen here [J] COG0009 Putative translation factor (SUA5) ... can be seen here [C] COG0277 FAD/FMN-containing dehydrogenases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:54 nt.    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.00 kcal/mol Antiterminator:    Distance from promoter:27 nt. Size=44 nt.     Delta G= -4.00 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -3.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: gtgaca-tatatt. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gtgacaacagatggatcttcgagtttatatttttcagattcacgccgtagcatgtaagattcagtgggtaatatttaagaaaattagagatttctatgag atatttcatgaaggaagtctttttttgtctgcaaagagggcagagtgatttgttttatgtgctatttttttctgtagggcttgcggaaaacgcatagcag tgcaaaaataacttcATG     rnhB --- BH04240 --- BH04250 Gene: rnhB     GI: 49475220     BI number: BH04230     GOG: COG0164     Description: Ribonuclease HII Gene: BH04240     GI: 49475221     BI number: BH04240     GOG: COG0009     Description: hypothetical protein Gene: BH04250     GI: 49475222     BI number: BH04250     GOG: COG0277     Description: Oxidoreductas   g a  a a  t t  t gc ta a  |        a cg       a  a gt       g  a a  g       at        ta t  |       at       a  t g  |       ta        gt cg        tg        at cg        ta        gc gt       a  g       ta c  a       ta        at a  a       at       |  g c  t       at       |  a t  |      t  |      |  a ta        gt        tg at        gc        cg gt        gt        ta at        ta        ta c  a       gt        tg ta       a  g       at tg       c  a       gc ta        tg        at ta        ta        gt ta        at        at                         ttttgtctgcaaagagggcagagtgatttgttttatgtgctatttttttctgtagggcttgcggaaaacgcatagcagtgcaaaaataacttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0164 Ribonuclease HII ... can be seen here [J] COG0009 Putative translation factor (SUA5) ... can be seen here [C] COG0277 FAD/FMN-containing dehydrogenases ... can be seen here     ..................................................................................................................