                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:33 nt.    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.40 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=29 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:    Distance from promoter:6 nt.    Size=26 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tatggt. It has a score value of 85.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgactgtttttatcatgtttaatatggttttcttgtgattttctgctaatatcaaatcacttgcttggctggctagttttgattggtgagtcaagcgtt
tttattatatgtaattttcaaaagttagaggggatgtttaacaaaaggttatgatgtgttATG

    hutA Gene: hutA     GI: 49475292     BI number: BH04970     GOG: COG1629     Description: Heme receptor precurso                      tt                     t  g             g        ta           g  c       gt           t  t       at ta        tg        tg c  a       cg        cg g  t       gc        gt t  a      t  t      g  g c  t       ta        ta t  c       cg        cg ta        at        gt ta       c  |       gc ta       t  |       ta at        at        ta gc        at        cg ta        at        gc gc        cg        tg                         tttttattatatgtaattttcaaaagttagaggggatgtttaacaaaaggttatgatgtgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here     ..................................................................................................................