                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=56 nt.     Delta G=-12.56 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTATAAAGATATCAAATTATTACAGCGTTATATTTCAGAACGTGGGAAAATTGTTCCT
TCACGGATTACAGCCATTAGTCAGAAAAAACAGCGTGAATTAGCTAATGCCATCAAAC
GCGCGCGTTTTCTTGGCTTGCTTCCATACGTTATAAAATAAaaaatgcgtctctgcagctggggaactcc
tcagccgcttttcttatatgatttggaaatagttcattttactataggaagatataaaatatcaaagttggggtatgacaatgctcctaactgctgaaag
caggacagcaataaATG

    BH05300 --- rplI Gene: BH05300     GI: 49475324     BI number: BH05300     GOG: NOG05854     Description: hypothetical protein Gene: rplI     GI: 49475323     BI number: BH05290     GOG: COG0359     Description: 50S ribosomal protein l             T GC       A  A C  G      A  A GC       A  a CG       A  a AT       T  a AT       A  a AT       T  t |  T       Tg C  C       Gc T  T       Cg AT        At CG       T  c CG       A  t GC       C  c T  T      C  t A  T      T  | A  |      T  | T  |       Cg        ac CG        Gc       a  t GC       T  |       gc AT        Ta        gc T  T       Cg        gt T  C       Gc        gc A  C      G  t       ta A  A      T  g       cg GT        Tg        gc TA        Cg       a  c GC        Tg        cg CG        Ta        gc                         ttttcttatatgatttggaaatagttcattttactataggaagatataaaatatcaaagttggggtatgacaatgctcctaactgctgaaagcaggacagcaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0359 Ribosomal protein L9 ... can be seen here     ..................................................................................................................