                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.04 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGGTTAATGCAGATAAGGTAGTAGAAGATGCGAGCTTTATCGATGATCTAGGAGCA
GATAGCCTTGATACGGTCGAGCTCGTTATGGCTTTTGAAGAAGAATTTGGTGTAGAAA
TCCCAGATGAGGCTGCTGAAACGATTTTCACAGTGGGTGATGCAGTAAAGTTTATTGA
TAAAGCTTCTGCATAAtttctaaaaggcaaaggtgtaaagtttaagatgcttttgcctatattctttgggggctattttgagaagaga
gctttgaagagtaaatctcaattcagggttgcaaagtcATG

    fabF1 Gene: fabF1     GI: 49475331     BI number: BH05370     GOG: COG0304     Description: 3-oxoacyl-[acyl-carrier-protein ] synthase I   G                  tt T  A                g  t T  T       tc       a  a A  A      t  t      a  a TA       t  a      a  g TA       A  a       ta TG       A  a       gt GC       T  a       tg AT       A  g       gc AT        Cg        gt A  |       Gc        at T  |       Ta        at GC       C  a       at AT        Ta        cg CG        Tg        gc GC        Cg        gc TA        Gt        at                         atattctttgggggctattttgagaagagagctttgaagagtaaatctcaattcagggttgcaaagtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here     ..................................................................................................................