                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTACCGTTCAGATCTTGAGAAGGAAACACCATATAATACGTATAAAATTAAGGGGTTG
CCACCAACAGCTATTGCGAATCCAGGTAGAGATTCTTTGAAAGCGGTGGCGCATTCAC
CGAGCAGTGATGTGCTCTATTTTGTAGCTGATGGTTCTGGAGGGCATGTTTTTTCTAG
AACTTTGGAGGAACATAATATAAATGTCCGCAAATGGCGTGCATTAAAAGCAACACAT
TAAttttttgggagactttagaaagcatgttattgaagtttgaagaaaagttaaaaaagtagaacgatATG

    gmk Gene: gmk     GI: 49475333     BI number: BH05390     GOG: COG0194     Description: Guanylate kinas GT G  A A  G C  A CG TA AT AT GC |  T C  T G  T TG TA A  A TA                  AG CG                 G  C GC                 C  A A  |                 CG C  |                 AT A  |        C        CG A  |      G  A      T  | CG       C  T       TA CG        GT        AT AT        GC        CG CG        TA        GT CG        GC        CG GC        GC        GC TG        CG        GT                         CTATTTTGTAGCTGATGGTTCTGGAGGGCATGTTTTTTCTAGAACTTTGGAGGAACATAATATAAATGTCCGCAAATGGCGTGCATTAAAAGCAACACATTAAttttttgggagactttagaaagcatgttattgaagtttgaagaaaagttaaaaaagtagaacgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0194 Guanylate kinase ... can be seen here     ..................................................................................................................