                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.50 kcal/mol
Antiterminator:    Distance from promoter:82 nt. Size=45 nt.     Delta G= -4.23 kcal/mol
Anti-antiterminator:    Distance from promoter:39 nt.    Size=52 nt.     Delta G= -9.62 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-TCAAAT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAATCGTGAAATAATCAACTCAAATCATGTGAAAGGCAACTAAgtaaaacataaggaaaac
caaccatttctattgcagcagtcatattagccgctggacgcggtaaaagagcaggatctcttccaaaaaaaccaaaacaataccgactcttaggacaaga
gccggttatttgccatactGTG

    BH05820 --- cinA Gene: BH05820     GI: 49475375     BI number: BH05820     GOG: COG0245     Description: hypothetical protein Gene: cinA     GI: 49475374     BI number: BH05810     GOG: COG1546,COG1058     Description: Competence /damage-inducible protein cin   g a  c t  c t  g a  c        a t  t      a  a a  g      a  a cg       a  c ta       a  c gc       c  a a  |      c  a cg       t  a gc       t  a a  g      c  c cg       t  a gt       c  a        g ta       t  t      g  a ta       a  a      a  c a  a       gc        ta ta        gc        ta cg       a  g       cg ta       c  a       ta tg        gc        cg t  c       at       a  c a  a       gc        gc cg        at        cg cg        at        cg                         ttatttgccatactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0245 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase ... can be seen here [R] COG1546 Uncharacterized protein (competence- and mitomycin-induced) ... can be seen here [R] COG1058 Predicted nucleotide-utilizing enzyme related to molybdopterin-biosynthesis enzyme MoeA ... can be seen here     ..................................................................................................................