Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:59 nt.    Distance to gene:151 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -9.20 kcal/mol
Antiterminator:    Distance from promoter:43 nt. Size=28 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgagc-taggat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagctacttgcagatccatgttttataggatttcatatccacagaaaggcaaagaccactcaaaaatctcaagaaggcagcttttacaattgggcact
gtctcgcattcttggtgctcatgatttgttctgttagagttgttattgctattttaaccattgggattttaattttgcctgaaggagcgttgattgtggc
ttacgcaagaaactagtgttagcctatggatgaaagcgttaaatgcgtgaaaagtgattgttatatgaacggaattaaaaatATG

    clpP


Gene: clpP     GI: 49475380     BI number: BH05880     GOG: COG0740     Description: ATP-dependent clp protease proteolytic subuni


 ca         c
a  a      g  a
t  t      c  t
t  t      t  t
 tg       c  c
 tg       t  t
 cg        gt
 gc        tg
|  a       cg
|  c       at
 at        cg
 cg        gc
 gt        gt
 gc        gc
 at        ta
            tgatttgttctgttagagttgttattgctattttaaccattgggattttaattttgcctgaaggagcgttgattgtggcttacgcaagaaactagtgttagcctatggatgaaagcgttaaatgcgtgaaaagtgattgttatatgaacggaattaaaaatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[OU] COG0740 Protease subunit of ATP-dependent Clp proteases ... can be seen here

    ..................................................................................................................