                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G=-13.85 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taattttgagagttAGGGGTATAGCTCAGTTGGTAGAGCGGCGGTCTCCAAAACCGCAGGTCGC
GGGTTCGAGCCCTGCTGCCCCTGCCAgacagttaggcttttaattattgagaaggtagattttactgccttcctttctttt
ttttgtgtggggcttgtttttttgtacgtgaatcggtattgagtagaggataagagaattgtataaggctgaagattggccttttgcatttttatcgtat
ttattttttttgttgtataactcacaataaggttagaaagagtatagtgtgactgATG

    secE --- nusG Gene: secE     GI: 49475392     BI number: BH06040     GOG: -------     Description: Preprotein translocase secE subunit Gene: nusG     GI: 49475393     BI number: BH06050     GOG: COG0250     Description: Transcription antitermination protei            aa tt       g  t t  t      t  c a  a      g  g gc        cg at        at tg        ta gc        gt gc       |  t at       |  g at       |  a gc       |  g |  c      t  t |  t       ta |  t       tg at        ta gc        tg |  t       tg |  t       ta |  t       gt |  t       ta t  t       ta t  t       cg         g a  t      |  a      a  a t  t      |  g       at t  g      g  a       gt a  t      g  a       tg a  g       gt        cg t  t       gt        gc tg       t  g       gc tg       g  t       at tg        ta        at cg        gt       t  t gc        ta        at gt        ta        tg at        tg        gc tg        tg        ta                         tttttatcgtatttattttttttgttgtataactcacaataaggttagaaagagtatagtgtgactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0250 Transcription antiterminator ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:150 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-10.00 kcal/mol Antiterminator: Size=44 nt.     Delta G= -5.21 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G=-20.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case taattttgagagttAGGGGTATAGCTCAGTTGGTAGAGCGGCGGTCTCCAAAACCGCAGGTCGC GGGTTCGAGCCCTGCTGCCCCTGCCAgacagttaggcttttaattattgagaaggtagattttactgccttcctttctttt ttttgtgtggggcttgtttttttgtacgtgaatcggtattgagtagaggataagagaattgtataaggctgaagattggccttttgcatttttatcgtat ttattttttttgttgtataactcacaataaggttagaaagagtatagtgtgactgATG     secE --- nusG Gene: secE     GI: 49475392     BI number: BH06040     GOG: -------     Description: Preprotein translocase secE subunit Gene: nusG     GI: 49475393     BI number: BH06050     GOG: COG0250     Description: Transcription antitermination protei   G         a G  T      c  g A  C      a  t CG       g  t GC       A  a CG        Cg CG        Cg A  G       Gc A  T      |  t A  T      |  t A  C      |  t C  |      |  t CG       |  a TA       |  a CG       |  t T  C      |  t GC       |  a GC       |  t |  T      |  t       tt CG       |  g      t  t GC       |  a      a  a GT       T  g       gc CG       C  a       at GC       C  a       tg |  C       Cg        gc A  C       Cg        gc GC        Gt        at AT        Ta        at TG        Cg        gc                         ctttcttttttttgtgtggggcttgtttttttgtacgtgaatcggtattgagtagaggataagagaattgtataaggctgaagattggccttttgcatttttatcgtatttattttttttgttgtataactcacaataaggttagaaagagtatagtgtgactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0250 Transcription antiterminator ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:157 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-10.00 kcal/mol Antiterminator: Size=44 nt.     Delta G= -5.21 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G=-26.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case taattttgagagttAGGGGTATAGCTCAGTTGGTAGAGCGGCGGTCTCCAAAACCGCAGGTCGC GGGTTCGAGCCCTGCTGCCCCTGCCAgacagttaggcttttaattattgagaaggtagattttactgccttcctttctttt ttttgtgtggggcttgtttttttgtacgtgaatcggtattgagtagaggataagagaattgtataaggctgaagattggccttttgcatttttatcgtat ttattttttttgttgtataactcacaataaggttagaaagagtatagtgtgactgATG     secE --- nusG Gene: secE     GI: 49475392     BI number: BH06040     GOG: -------     Description: Preprotein translocase secE subunit Gene: nusG     GI: 49475393     BI number: BH06050     GOG: COG0250     Description: Transcription antitermination protei   G G  T A  C        a CG       g  c GC       A  a CG       C  g CG       C  t A  G       Gt A  T       Ta A  T       Cg A  C      |  g C  |      |  c CG       |  t TA       |  t CG       |  t T  C      |  t GC       |  a GC       |  a |  T      |  t CG       |  t GC       |  a       tt GT       |  t      t  t CG       |  t      a  a GC       C  g       gc |  C      C  a       at A  C      C  g       tg GC        Ga        gc AT        Ta        gc TG        Cg        at GC        Gg        at GC        Tt        gc                         ctttcttttttttgtgtggggcttgtttttttgtacgtgaatcggtattgagtagaggataagagaattgtataaggctgaagattggccttttgcatttttatcgtatttattttttttgttgtataactcacaataaggttagaaagagtatagtgtgactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0250 Transcription antiterminator ... can be seen here     ..................................................................................................................