Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:43 nt.    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:36 nt. Size=16 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G= -8.42 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-GTTAAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAGTTTAGCCGAATTGGGGGTTAATCGTTGAttttaaaatatatttcatttactcatctttgaggattgc
ctttctcttaaaagagagaggctttattgttctctcatgatagacatgaacagagtgtgaaatgtgtcagtcatttgggaggagtagtctaactaaaaga
gctgcaaaattttttgcaatgcattgatgttaaatgagaaaacaataatattcaaatttattttttaagaagaaagtaaaaacaATG

    pnbA


Gene: pnbA     GI: 49475401     BI number: BH06130     GOG: -------     Description: Nitroreductas


 TT
A  G
A  G
G  G
 CG
 CG
 GT
 AT
 TA
 TA
|  T
|  C
|  G
|  T
|  T
|  G
|  A
|  t
|  t
|  t
|  t
|  a
|  a
|  a
|  a
|  t
|  a
|  t
|  a
|  t
|  t
|  t
|  c
|  a
|  t
|  t
|  t
 Ta
 Gc
 At
 Gc                  aa
|  a                t  a
 At                  ta
 Gc                  cg
T  t       gc        ta
T  t      t  c       cg
T  |      t  t       ta
 At        at        tg
 Tg        gt        ta
 Ta        gc        cg
 Tg        at        cg
 Cg        gc        gc
                        tttattgttctctcatgatagacatgaacagagtgtgaaatgtgtcagtcatttgggaggagtagtctaactaaaagagctgcaaaattttttgcaatgcattgatgttaaatgagaaaacaataatattcaaatttattttttaagaagaaagtaaaaacaATG


    ..................................................................................................................