                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:130 nt.    Distance to gene:45 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G= -9.70 kcal/mol
Antiterminator:    Distance from promoter:99 nt. Size=43 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:    Distance from promoter:68 nt.    Size=50 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgatt-tatatt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgatttagcaaatttatcctttatatttatgggaatattgaggtattaagcattaacgagctaaacagttttggttaggggtcttttatatgaatgtgg
gggagaaactttcagcaatttaaataaagcagtttttgggtatcacttttctttggttacggcatgtgcttttgttaaaagcgtcatagggtcgtggctg
ttttgagtggtattgttagaggttcatgaagttcttttaaacaatgcttcATG

    BH06660 Gene: BH06660     GI: 49475450     BI number: BH06660     GOG: COG2831     Description: Hemolysin activator protein he aa t  a t  t t  a a  a a  a cg        tt gc       t  c        t a  |      t  t      g  t c  |      c  t       ta t  |       at        ta t  |       cg        ta ta        tg        ta cg        at        cg at       t  t       gc at       g  a       tg at       g  |      |  t gt        gc        gc at        tg        ta |  g       tg        at |  g      t  c      |  a g  g      t  a      |  g g  t      t  t      |  g g  a      g  g       cg gt        at        gt gc        cg        gc ta        gc        cg gc        at        at                         ggctgttttgagtggtattgttagaggttcatgaagttcttttaaacaatgcttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG2831 Hemolysin activation/secretion protein ... can be seen here     ..................................................................................................................