                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caaaggatcttgtctttccagaccctcgtcctccccaagcagcacgcaccgccgccttacctgtaaaaatcgctataagctttgggacaatcTTAAT
CTGTCGTGTTGTCATGACCCAAAGGCGCGATTTCCACGCGCCCTATCATCTTAATCGC
CCCGCCATCCTCCCCTGTCACTTGCAATGGCAACACCTTACCAAGCAACGCTAAATAA
GCGGCGGGGCATTTAAGTGCCTGTTTTTCCAGATAAGAGATTAATCCTTCTTTACCAT
ATTTACTGCCTGCTCGTTTAGCAGCTTCAATG

    BH07110 --- BH07100 Gene: BH07110     GI: 49475493     BI number: BH07110     GOG: -------     Description: hypothetical genomic island protein Gene: BH07100     GI: 49475492     BI number: BH07100     GOG: -------     Description: hypothetical genomic island protei   A A  C C  A GC GC T  T A  T       TA A  A      A  A C  C      A  G GC       A  C TA        TG        TA TA        CG       T  A CG        GC        TG A  C       CG        AT C  A      A  G       CG TA       A  G       GC GC        CG        GC TG        GC        GT                         GTTTTTCCAGATAAGAGATTAATCCTTCTTTACCATATTTACTGCCTGCTCGTTTAGCAGCTTCAATG     ..................................................................................................................