Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance from promoter:130 nt. Distance to gene:45 nt. Distance to run of Ts=3 nt. Size=37 nt. Delta G= -9.70 kcal/mol
Antiterminator: Distance from promoter:99 nt. Size=43 nt. Delta G= -3.70 kcal/mol
Anti-antiterminator: Distance from promoter:68 nt. Size=50 nt. Delta G= -4.30 kcal/mol
Nomenclature/Definitions
The most likely promoter is: atgatt-tatatt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
atgatttagcaaatttatcctttatatttatgggaatattgaggtattaagcattaacgagctaaacagttttggttaggggtcttttatatgaatgtgg
gggagaaactttcagcaatttaaataaagcagtttttgggtatcacttttctttggttacggcatgtgcttttgttaaaagcgtcatagggtcgtggctg
ttttgagtggtattgttagaggttcatgaagttcttttaaacaatgcttcATG
BH07140
Gene: BH07140 GI: 49475496 BI number: BH07140 GOG: ------- Description: Hemolysin activator protein he
aa
t a
t t
t a
a a
a a
cg tt
gc t c t
a | t t g t
c | c t ta
t | at ta
t | cg ta
ta tg ta
cg at cg
at t t gc
at g a tg
at g | | t
gt gc gc
at tg ta
| g tg at
| g t c | a
g g t a | g
g t t t | g
g a g g cg
gt at gt
gc cg gc
ta gc cg
gc at at
ggctgttttgagtggtattgttagaggttcatgaagttcttttaaacaatgcttcATG
..................................................................................................................