                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:176 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=53 nt.     Delta G= -5.77 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagttttgtagttggtattttttctacgatgaaaagatgtacgagcatatttggtattcataaactttgcatatcaattcaaaaaatacacgataatttt
atagttattgtgatttcatttttatgaactgaagaagcatactgatgaatattacagatatttgggaaaaaatacttttatcaggcatcatttcgtttct
ttgtggtttacaattttttttatcattttatcttgaccaaaagggagtgtttatgaacttctctttatctattttatttcaaaagggtggagttatatta
ATG

    divK Gene: divK     GI: 49475550     BI number: BH07800     GOG: COG0784     Description: Response regulato             a           a  c           a  t           t  t cg        at a  a       cg t  t      t  c cg        ta ta        at ta        ta ta        gt        ta ta        gc       t  t tg        ta        ta |  a       ta        tg |  t      t  t       at tg       a  t       at at       t  c       ta ta       a  a       at gc       c  a       gt g  g      g  a       cg ta       a  a       at tg       g  a       cg gc       c  a      a  | |  a       at        ta at        ta        at ta        gc        at gt        ta        at                         catttttatgaactgaagaagcatactgatgaatattacagatatttgggaaaaaatacttttatcaggcatcatttcgtttctttgtggtttacaattttttttatcattttatcttgaccaaaagggagtgtttatgaacttctctttatctattttatttcaaaagggtggagttatattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0784 FOG: CheY-like receiver ... can be seen here     ..................................................................................................................