Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:178 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:150 nt. Size=42 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:    Distance from promoter:146 nt.    Size=18 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgctg-tatagt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgctgattatatgtatctcatctatagttacagtttcaataagtgaagttttccatgccccctattgtcaaatctttgcatatgattctcaaaaagaca
ttactaaaccaggccaaaattcatttactgcctcgcaaattaaaaattgcctcttgcaaaatggctttaggaatattaaacgattgcgtttagatgacaa
aggtatttggcgcgctttagtagaatttaaaaagtgccatttttttgtatctgtcgattattctggaatagttagcattcaaaATG

    BH08560


Gene: BH08560     GI: 49475619     BI number: BH08560     GOG: -------     Description: hypothetical protei


           aa
          a  g
           cg
           at
          g  |
           ta
           at        ga
           gt       a  a
           at       t  t
           tg        gt
           tg        at
          |  c       ta
           tg        ta
 tt        gc        ta
a  g       cg       c  a
 gc        gc       g  a
 cg       t  t       cg
 at       t  t       gt
 at       a  t       cg
 at       g  a       gc
 ta        cg        gc
 tg        at        ta
                        tttttttgtatctgtcgattattctggaatagttagcattcaaaATG


    ..................................................................................................................