                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.13 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGATAGAGATAGGTTATTTATCAAATAAAGAGGATGAAAAATTATTAAATAATCCC
CAATGGAGAAAACAAATGGCTGCTTCTATCGCTTATTCTATTCGTCAATTCGCTGAGT
ATAGACAGAAAATTATGCAGCCTCTTTAAatggggggggaaatagagtattaatataattttatagtataaatatagag
atgaaaaacagttttttctcgcagtagtatttcatgtcgcctttttgttggtgaggtgatgtgtttttttttctcattctaaagaaagcgatagccgttt
tgatgATG

    mrcA2 Gene: mrcA2     GI: 49475633     BI number: BH08700     GOG: COG5009     Description: Penicillin-binding protein 1   c t  t t  c t  g t  c t  a        t t  g      g  t g  t      t  g a  a      t  g cg       t  t at        tg a  a       ta at        cg at        cg at        gt gc        cg ta        ta at        gt g  g       tg at        at gc        cg             tttttttttctcattctaaagaaagcgatagccgttttgatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5009 Membrane carboxypeptidase/penicillin-binding protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:38 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-11.80 kcal/mol Antiterminator: Size=41 nt.     Delta G= -5.13 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTTGATAGAGATAGGTTATTTATCAAATAAAGAGGATGAAAAATTATTAAATAATCCC CAATGGAGAAAACAAATGGCTGCTTCTATCGCTTATTCTATTCGTCAATTCGCTGAGT ATAGACAGAAAATTATGCAGCCTCTTTAAatggggggggaaatagagtattaatataattttatagtataaatatagag atgaaaaacagttttttctcgcagtagtatttcatgtcgcctttttgttggtgaggtgatgtgtttttttttctcattctaaagaaagcgatagccgttt tgatgATG     mrcA2 Gene: mrcA2     GI: 49475633     BI number: BH08700     GOG: COG5009     Description: Penicillin-binding protein 1   c t  t t  c t  g t  c t  a t  g g  t       tt a  a      t  g cg       t  t at       t  t a  a       cg at        cg at        gt at        cg gc        ta ta       g  g at        tg g  g       at at        cg gc        ta             tgtgtttttttttctcattctaaagaaagcgatagccgttttgatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5009 Membrane carboxypeptidase/penicillin-binding protein ... can be seen here     ..................................................................................................................