Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:208 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagactttttatggatgaaaagtctttatgttagctaggattgcgttataagattagctggttcggatatccgaacttttttaaagattgttttgccgga
gacttacaaaaatatgagtcatacaaaacagatggaaatgatgatgaaaaatgctttcagtgcaatcatacatctgcacttgattccccatcctgttttg
ctggcacctcccttttatggcagacagccctttatgtttacgaatagtcatgctgttcgttttaatcaaattgcgcatgtcgccttcaggattttaactt
ATG

    rne


Gene: rne     GI: 49475635     BI number: BH08720     GOG: COG1530     Description: Ribonuclease


  c
a  t
a  t
t  A
t  T
 tG
 tg
 at         t
 gc       g  t
 gt       c  a
|  t       gt
|  t       ta
|  a       ta
 at       a  g
 cg       g  a
t  t       gt
t  t       at
c  a       ta
 cg        cg
 gc        gc
|  t       at
|  a       tg
|  g       tg
 cg       g  t       ta
 ta       t  t      a  t
 gt       a  c       gc
t  |      t  |       gc
 at       t  |       cg
 cg        tg        ta
 gc        cg        ta
 cg        ta        gc
 gt        gt        gt
                        tttttaaagattgttttgccggagacttacaaaaatatgagtcatacaaaacagatggaaatgatgatgaaaaatgctttcagtgcaatcatacatctgcacttgattccccatcctgttttgctggcacctcccttttatggcagacagccctttatgtttacgaatagtcatgctgttcgttttaatcaaattgcgcatgtcgccttcaggattttaacttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG1530 Ribonucleases G and E ... can be seen here

    ..................................................................................................................