                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:49 nt.    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:27 nt. Size=36 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.93 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAAA-TAGAAT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAAACAACTAGGGGGATGTGATAGAATACGTGAAAAGTGGCTTTTATATTCCGCTC
ATTCTGGACAATATGTCAAAATAGTCAATGATGAAAAAATCATTGAAGGTATTTTTGA
TGGTCTTGATAATGATTTTAACTGCGTCATAAAACAAAAAAATGGTCAGCAAGCAGTT
ATAACAGCTGGAGATGTTCATTTTGGTTCGTCTGCTTCTGTAAATGCAGGTTGTTATT
AAttgataaaactttctttcatcatcaaattgttttaagaggatatgtgtATG

    BH08800 Gene: BH08800     GI: 49475643     BI number: BH08800     GOG: COG0595     Description: hypothetical protei TA T  T T  A T  T C  T GC GC TG GC AT |  C       CA A  A      T  A AT       G  A AT        TA GC        AT        AA |  T       TA       A  A T  G      A  |      G  A G  G      A  |       TA C  A       CG        AT A  C       AT        GC T  A       GC        TA A  A      G  A       AT A  T      T  A       AT G  A      C  T       CG AT        TG        TA TG        TA       G  A AT        AT       A  G GC        CG        TG TA        TA        AT                         ATTTTTGATGGTCTTGATAATGATTTTAACTGCGTCATAAAACAAAAAAATGGTCAGCAAGCAGTTATAACAGCTGGAGATGTTCATTTTGGTTCGTCTGCTTCTGTAAATGCAGGTTGTTATTAAttgataaaactttctttcatcatcaaattgttttaagaggatatgtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0595 Predicted hydrolase of the metallo-beta-lactamase superfamily ... can be seen here     ..................................................................................................................