                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:132 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.10 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=46 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:    Distance from promoter:54 nt.    Size=49 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAA-TATTAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAACAGAAACGCGTGAGGAGCTTTATTATGATAAAGAAAAGCTTTTAATGAATGG
AGATCGCTGGGAGAGAGAAATCGCTCGAAATATATTGATGGATGCACCTTATCGTTAA
gtgtatcattaaatgggttgtcggataattttttcgataaattgtaatttggtatgaagtattataccgattgtttgattaattgaggagaagcctATG

    nuoJ --- nuoK --- nuoL --- nuoM --- nuoN --- birA Gene: nuoJ     GI: 49475649     BI number: BH08860     GOG: COG0839     Description: NADH dehydrogenase I, J subunit Gene: nuoK     GI: 49475648     BI number: BH08850     GOG: COG0713     Description: NADH dehydrogenase I, K subunit Gene: nuoL     GI: 49475647     BI number: BH08840     GOG: COG1009     Description: NADH dehydrogenase I, L subunit Gene: nuoM     GI: 49475646     BI number: BH08830     GOG: COG1008     Description: NADH dehydrogenase I, M subunit Gene: nuoN     GI: 49475645     BI number: BH08820     GOG: COG1007     Description: NADH dehydrogenase I, N subunit Gene: birA     GI: 49475644     BI number: BH08810     GOG: COG0340,COG1654     Description: Biotin-protein ligase bir CG         t T  T      a  t AT       a  t TA       t  t TA        at C  |       gt Cg        gc At        cg Cg        ta Gt        gt Ta        ta At        ta Gc       |  a G  a      |  t T  t      |  t       gt A  t      g  g      a  a G  a      g  t       at Ta       g  a       gt Ta        ta        ta At        at        at Tg        at        ta A  g       at        gc Tg        tg        gc At        tg        tg At        at        ta                         ttgtttgattaattgaggagaagcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0839 NADH:ubiquinone oxidoreductase subunit 6 (chain J) ... can be seen here [C] COG0713 NADH:ubiquinone oxidoreductase subunit 11 or 4L (chain K) ... can be seen here [CP] COG1009 NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit ... can be seen here [C] COG1008 NADH:ubiquinone oxidoreductase subunit 4 (chain M) ... can be seen here [C] COG1007 NADH:ubiquinone oxidoreductase subunit 2 (chain N) ... can be seen here [H] COG0340 Biotin-(acetyl-CoA carboxylase) ligase ... can be seen here [K] COG1654 Biotin operon repressor ... can be seen here     ..................................................................................................................