                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAATAAATACTTGGGTTTTATGTTTAAGACGCCGGAATGCGTTAGAGTGAATAATA
CGATCTCTATCTCGTTGAAAAGGTGATCGTAGAGTATTCATAGTTTCATGGAATAATC
TGCCACGGCTTGTTTGCGGATTGGCACTATAGACCGCTCGAGATTGGTAATTGAAATT
GATCTTGCTTTTATCCATtgcaagctatccatttccatcctaaatttaaattgaaattattgtattatgaataaattcttgtttagg
atactctttcttgatagtttaatgcaaggatatataaaaATG

    BH09960 --- BH09950 Gene: BH09960     GI: 49475741     BI number: BH09960     GOG: COG0316     Description: hypothetical protein Gene: BH09950     GI: 49475740     BI number: BH09950     GOG: NOG05081     Description: hypothetical protei AC C  T G  A GT TA TG A  A GC GC CG GC         T T  T      T  G T  |      A  A T  |      A  A GC        TA TG        GT TA       G  T CG       T  G G  A       TA G  T       AT C  |       GC AT        AT CG        GT CG        CG             CTTTTATCCATtgcaagctatccatttccatcctaaatttaaattgaaattattgtattatgaataaattcttgtttaggatactctttcttgatagtttaatgcaaggatatataaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0316 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................