                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:72 nt. Size=24 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-aaaatt. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaattaagacaaatccttttaaaaattattctaacagttgcttttgaatgtagaaacaaagcatcatcgttgtcttgtttgtaaaatagacatgaaat
atagtcttaaattagataggggctggtaagatcttttcccttttttagggaggggaggtcaacttaaaccttatgagataggtagaaccttgaaaaacca
gtcggttttttaaaaatatcagagataaaacaatATG

    BH10180 Gene: BH10180     GI: 49475762     BI number: BH10180     GOG: COG5387     Description: hypothetical protei ta        ag t  g      a  a a  a      t  t a  t       gc a  a       gt tg       t  t tg       c  t cg        gt tg        gc gc        gc at        gc tg        at             tttttagggaggggaggtcaacttaaaccttatgagataggtagaaccttgaaaaaccagtcggttttttaaaaatatcagagataaaacaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG5387 Chaperone required for the assembly of the mitochondrial F1-ATPase ... can be seen here     ..................................................................................................................