                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-17.95 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGTTGCAATGAATGTTAAGCGTTTGATGGATCTTGGTTGTTATCGAGGATTACGTCA
TCGCCGTTCTTTACCTGTTCGTGGGCAGCGTACGCATACAAATGCGCGCACTCGTAAA
GGACCGGCTAAGGCAATTGCCGGTAAGAAAAAATAGcaattgccgataaggaaaaataagagtctctttaaag
aaggcttttgttttttttagtgttctatttcttgttaagaatttttaacaagaataaattaggtggagctgctggtgttacggcagtgcagagatcgttg
gaaggaaagctATG

    rpsK Gene: rpsK     GI: 49475771     BI number: BH10280     GOG: COG0100     Description: 30S ribosomal protein s1             A           G  A           A  A           A  A           T  A           G  A           G  T           C  A            CG            Gc            Ta            Ta            At            At            Cg            Gc            Gc           A  g           A  a           T  t           C  a       ta           G  a      t  a           G  |       ta            Cg        cg            Cg       |  a           A  a       ta GC       G  a       cg G  A      G  a       tg A  A      A  a       gc A  T      A  a       at T  T      A  t       gt CG       T  a       at GC       G  a       at GC        Cg        tg CG        Ta        at CG        Cg        at AT        At        at                         tttttagtgttctatttcttgttaagaatttttaacaagaataaattaggtggagctgctggtgttacggcagtgcagagatcgttggaaggaaagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0100 Ribosomal protein S11 ... can be seen here     ..................................................................................................................