                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -8.12 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=63 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGTGAGAAGACAGCTCCTTTGTCGGAATTTTATTTGCAAAGGAGATTATTGAAGCT
AGTTGATGGAATGATTGGTGTTACTGAGGTATCACGCAAAATTAGAGAGGTTCTTAAA
TAGggatttttttagaaataaatgaaaagagttgactttttgggtgaaatctatcaaaaactgctttaatctatttcattaaaatgattaggattcgg
aaaatgtttattgccggatctgtttcttctgtaaagtacatcaggtattttatggttaattgtcaatataatcaaggagaacaggcGTG

    rpsM Gene: rpsM     GI: 49475772     BI number: BH10290     GOG: COG0099     Description: 30S ribosomal protein s1   a g  a ta gt gc gt ta t  t t  c t  a t  a c  a a  | g  | ta ta gc at |  g gc                   t at        aa       g  t at       t  a      t  t at        ta       a  a a  a       at       a  t g  |       cg       a  t ta        ta       a  g at       t  t       gc a  c      t  t       gc at       a  a       cg ta        tg        tg at        cg        ta at        ta        at at        at        gc gc        at        gt                         gtttcttctgtaaagtacatcaggtattttatggttaattgtcaatataatcaaggagaacaggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0099 Ribosomal protein S13 ... can be seen here     ..................................................................................................................