                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGGTCATGTAGAATTGTCTGCGTATTGTATTTCTTCTGCAGAGAAGATTGCAAAGG
ATGTGTTGCGTCCGGCTATAGCAGAGTGGTTACAGCATAAATTGCCCGTTTTGCTTGA
AGATATTTTACGGGAAGAGATCGTTAGGGCAATTAAGAAGTCGTCTTAAtttttttctcattat
tttcttatatgttcgttttgtttgtagttttgcagattttatgtgagtaattgggttttgcagagagtatgatcggatttagatcgtacggtgcactttt
gtgcgttatggatgaagagaATG

    valS Gene: valS     GI: 49475806     BI number: BH10630     GOG: COG0525     Description: Valyl-tRNA synthetas tt g  t at tg gc ta        ta         t tg       g  a      a  t ta        at       g  t gt        gt       g  a t  t       tg        cg t  t      g  g       ta t  |       tg        at t  |       at        gc g  |      t  |       tg c  |      t  |       at t  |      t  |       ta t  |      t  |       gc gt        at       a  g ta        gt       g  g at        at       a  | tg        cg       g  | at        gc        at tg        ta        cg ta        tg        gc cg        ta        ta                         cttttgtgcgttatggatgaagagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0525 Valyl-tRNA synthetase ... can be seen here     ..................................................................................................................