                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:59 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:54 nt. Size=17 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:    Distance from promoter:16 nt.    Size=48 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttata-tatatt. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttataagaaagatttttcttaatatattttgtgcattggagtaatggggggataatcatacaatctatgttttgtgtgtagtaggctctctaagagcct
ttttttatgggctcttctggggtctttttttattgtgctatcaagtagacgagtgggaaaATG

    ilvB Gene: ilvB     GI: 49475826     BI number: BH10920     GOG: COG0028     Description: Acetolactate synthase isozyme III large subuni at t  g c  t t  t at at cg at                  tt tg                 t  t at                 t  a cg                 t  t |  t                 tg t  a                 cg a  g                 cg at                  gc ta                  at |  g        t        gc a  g      c  a       at gc       t  a      |  t gt        cg       |  c gc        ta        at gt        cg        tg gc        gc        cg gt        gc        tg ta        at        cg                         tctttttttattgtgctatcaagtagacgagtgggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:54 nt.    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -8.90 kcal/mol Antiterminator:    Distance from promoter:16 nt. Size=48 nt.     Delta G=-13.90 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G= -6.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttata-tatatt. It has a score value of 75.64 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttataagaaagatttttcttaatatattttgtgcattggagtaatggggggataatcatacaatctatgttttgtgtgtagtaggctctctaagagcct ttttttatgggctcttctggggtctttttttattgtgctatcaagtagacgagtgggaaaATG     ilvB Gene: ilvB     GI: 49475826     BI number: BH10920     GOG: COG0028     Description: Acetolactate synthase isozyme III large subuni            at   c       t  g g  a      c  t t  t      t  t gt        at tg        at tg        cg ta        at tg        tg at        at ta        cg a  a      |  t t  t      t  a a  g      a  g a  g       at tg        ta tg       |  g        t cg       a  g      c  a tg        gc       t  a ta        gt        cg t  t       gc        ta ta        gt        cg ta        gc        gc at        gt        gc gc        ta        at                         ttttttatgggctcttctggggtctttttttattgtgctatcaagtagacgagtgggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here     ..................................................................................................................