                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCATACTCCGATGGTGATTTCACCAAATGAGGATTTCTTTTTCTATTTTCGTAATT
TACTACAGGCAAGGGAGAAACTTTCATCGACAATGAACACTAATGGGAATACTGGACT
TAATAAAACTGTTTCAAAATTTGGAGGAGAATAGatgaaacacttgattgcgaacacaagatttcgcgtgataag
tgtaatatttgattgctttcttttaggatgaaaatgggtattgagccatactgattttgcagagataaatttggtgtggctcttttcagtatttagttag
aggcgtgttATG

    htrA3 Gene: htrA3     GI: 49475828     BI number: BH10940     GOG: -------     Description: Serine proteas   t t  t a  g ta at at tg gc                  ga |  t       ag       a  g |  t      g  c      c  a t  t      t  c       gt gc        ta        ta at        at        ta at        ta        ta t  t       gc       t  t a  t       gt        at g  a      g  g       gt t  g       ta        tg g  g       at        cg c  a       at        at gt        at        tg cg        at        at ta       |  g       cg ta        gc        cg ta        ta        gc                         tcttttcagtatttagttagaggcgtgttATG     ..................................................................................................................