Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:62 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:121 nt. Size=25 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=72 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCG-TAAAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCGATCCTGTTTCGCCCCCACTAAAATATAAAAAAACAAATTATATTTTGGTGGA
GGCGCCGGGTACCGCCCCCGGGTCCAATAAGCTTATTTCATTGTCCATTTATTACCAT
AGCTGGCAAGCCAGCTCTTTAAGTATAGATgaagaacagcttttggaaaaggggggttgttaatattttaaatcctct
aattatttagaagctatatgatgcggttgtaaaatacagccgctaattcttggagaggagatggtgtagaATG

    BH11020


Gene: BH11020     GI: 49475836     BI number: BH11020     GOG: NOG07121     Description: hypothetical protei


 AA
C  G
 GC
 GC
 TA
 CG
 GC
 AT
T  C
A  T
C  T
C  |
A  |
T  |
T  |
 AT
 TA
 TA
 TG
 AT
C  A
C  T
T  A
G  |
 TG
 TA                  ta
 AT         a       a  t
 Cg       a  a      a  t
 Ta       g  a      t  t
 Ta       g  g      t  t
 Tg        tg       g  a
|  a       tg        ta
A  a       tg        ta
T  c       tg        gt
 Ta        cg        gc
 Cg        gt        gc
 Gc        at        gt
 At        cg        gc
 At        at        gt
                        aattatttagaagctatatgatgcggttgtaaaatacagccgctaattcttggagaggagatggtgtagaATG


    ..................................................................................................................