                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGTTGCAAATGACAACTATGCGGAAGCACGTCTCGCTGCCTGAGGTGGTGTGAATGC
TTCAAACTAAGTCTTAAACCGTCGCAGGTTTAAGCGGGGTTCGAAGGCACCTGGCAAC
AGAAGCCTTCACTTTTGTAagtataactgattgagctttcaaacactatttatcataaaatttcgcattttttgcaattaataaga
tgcatcatagataaaatattgctaacttaaagaaacattttattgcacgatatcgttcatgttcaactgctgtgtaaaataaaaaggaataaatttcgAT
G

    BH11040 --- BH11050 --- BH11060 Gene: BH11040     GI: 49475837     BI number: BH11040     GOG: COG3814     Description: hypothetical protein Gene: BH11050     GI: 49475838     BI number: BH11050     GOG: -------     Description: hypothetical protein Gene: BH11060     GI: 49475839     BI number: BH11060     GOG: COG4321     Description: hypothetical protei CG T  C G  A CG CG AT AT                  CA AT                 G  A TA                  GC TA        GA        TA CG       C  A       CG T  C      T  G      C  A G  G       TG       A  A A  G       GC        CG A  |      |  A       GC TG        GC        GC CG        GC        AT AT        GT        AT AT        CG        GC                         ACTTTTGTAagtataactgattgagctttcaaacactatttatcataaaatttcgcattttttgcaattaataagatgcatcatagataaaatattgctaacttaaagaaacattttattgcacgatatcgttcatgttcaactgctgtgtaaaataaaaaggaataaatttcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3814 Uncharacterized protein conserved in bacteria ... can be seen here [R] COG4321 Uncharacterized protein related to arylsulfate sulfotransferase involved in siderophore biosynthesis ... can be seen here     ..................................................................................................................