                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-10.21 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTGCATCCCCATGTTTCACAAGATCAGCGTAATTTTGTAAGTGAAGAAGATCAGTT
GGAAATACCAGCATTTTTGCGTCGTCAGGCAAATTAAttggtaaaaaattagagagaggaaagttatttccct
tcttttatgatgagtaaaagttttgtacagtaaatttactgtgtttgaggcaagactctgttgtttataaacccgcttgtaataagcgggtttattattt
gctatgaatataatctttatcgttttataaatatttttaaaggccgtaaaaattattcaatgaagtgacATG

    lpxC Gene: lpxC     GI: 49475848     BI number: BH11170     GOG: COG0774     Description: UDP-3-o-[3-hydroxymyristoyl ] N-acetylglucosamine deacetylas             t           c  c           a  t at       g  g a  t       at at        at ta        cg gc        gt at        gt cg        at at       |  a |  g       gt |  t       ta         a |  t       ta       t  a |  t       ta        gt |  g       gc        ta |  a      |  c       ta |  g      |  c       cg tg        tg        gc gc        gc        cg ta       |  t       cg ta       t  t       cg tg        cg        at ta        at        at gc        ta        at at        ta        ta                         ttatttgctatgaatataatctttatcgttttataaatatttttaaaggccgtaaaaattattcaatgaagtgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0774 UDP-3-O-acyl-N-acetylglucosamine deacetylase ... can be seen here     ..................................................................................................................