Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance from promoter:53 nt. Distance to gene:105 nt. Distance to run of Ts=0 nt. Size=31 nt. Delta G= -9.20 kcal/mol
Antiterminator: Distance from promoter:23 nt. Size=37 nt. Delta G= -8.10 kcal/mol
Anti-antiterminator: Size=44 nt. Delta G= -3.06 kcal/mol
Nomenclature/Definitions
The most likely promoter is: tggaga-tataat. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
tggagacttgtaagttttcatatataatttttccgattacaataccagtttattcatttccatcggcgggaatagcgaggagggggattgctagtttttt
tagcaattgtttgtttttcattattgtcaaaaaaatatgaacataaatgatgcaactctatgccttctgcttaattttctattcataggaataaatgctt
atctgagcagtaaggaatattcATG
BH11370
Gene: BH11370 GI: 49475866 BI number: BH11370 GOG: ------- Description: Regulatory protei
tt
g t
a a a
c t g a
c t g t
a c g a
t a cg t
a t gc t t
a t g | t t
c t cg gt
a c ta at
t c a | ta
ta cg cg
at cg gc
gc ta ta
cg tg ta
cg tg at
t c a g gt
t g cg g g
tg tg gt
tg ta gt
ta at gt
gtttttcattattgtcaaaaaaatatgaacataaatgatgcaactctatgccttctgcttaattttctattcataggaataaatgcttatctgagcagtaaggaatattcATG
..................................................................................................................