                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:84 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.70 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=37 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=33 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: taaaaa-tataat. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taaaaatatgagaattttttcaatataatcggtgaaatgcttcgtatccttttattattttttatatggaaaataggaattctgtactatataataagta
aaaatatagttttcggattccaaaagcaattttggaggccgtttttcgtgtttttattaaaccttccgtgtaatagaaagggacggattATG

    greA --- lpcC Gene: greA     GI: 49475893     BI number: BH11700     GOG: COG0782,COG1747     Description: Transcription elongation factor greA Gene: lpcC     GI: 49475892     BI number: BH11690     GOG: COG0438     Description: Lipopolysaccharide core biosynthesis mannosyltransferase lpc             g           a  t   a       a  a a  t      t  a g  t      a  a gc       a  a at        ta        ca tg        at       g  a at        ta        at a  a       at        at a  |       ta        at a  |       cg        at gc        at        cg gt       |  t       cg ta       |  t       ta at       t  t       tg ta        gc       a  g at        tg        gc ta        cg        gc ta        ta        cg                         tttttcgtgtttttattaaaccttccgtgtaatagaaagggacggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [S] COG1747 Uncharacterized N-terminal domain of the transcription elongation factor GreA ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:84 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.70 kcal/mol Antiterminator:    Distance from promoter:50 nt. Size=37 nt.     Delta G= -6.40 kcal/mol Anti-antiterminator:    Distance from promoter:32 nt.    Size=33 nt.     Delta G= -5.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: taaaaa-tataat. It has a score value of 70.28 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case taaaaatatgagaattttttcaatataatcggtgaaatgcttcgtatccttttattattttttatatggaaaataggaattctgtactatataataagta aaaatatagttttcggattccaaaagcaattttggaggccgtttttcgtgtttttattaaaccttccgtgtaatagaaagggacggattATG     greA --- lpcC Gene: greA     GI: 49475893     BI number: BH11700     GOG: COG0782,COG1747     Description: Transcription elongation factor greA Gene: lpcC     GI: 49475892     BI number: BH11690     GOG: COG0438     Description: Lipopolysaccharide core biosynthesis mannosyltransferase lpc             a           a  g   a       t  t a  t      a  a g  t      a  a gc       t  a at        aa        ca tg        ta       g  a at        at        at a  a       ta        at a  |       ct        at a  |       aa        at gc        tg        cg gt       |  t       cg ta       |  t       ta at       g  t       tg ta        tt       a  g at        cc        gc ta        tg        gc ta        tg        cg                         tttttcgtgtttttattaaaccttccgtgtaatagaaagggacggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [S] COG1747 Uncharacterized N-terminal domain of the transcription elongation factor GreA ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................