Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance to gene:203 nt. Distance to run of Ts=1 nt. Size=33 nt. Delta G=-13.50 kcal/mol
Antiterminator: Size=30 nt. Delta G=-14.60 kcal/mol
Anti-antiterminator: Size=36 nt. Delta G= -6.70 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ccaacaacagtttttgtatgaatatgaagatatacgctgataggcagcgcttgctccattctgcgttgcctccaagggtgtctacgcagaagttttctct
ataattcaaaccattcatagatgcaagagttgtgggaaaaatcgatgatttctaccgttaagagagaggaaatgttacaagcatggtctagatggacaat
aaatcaatacgagccggattcaaaatcaaatagtggagacgttatgaaggtggagatcgccttgggtgagatggcagaaggtaatgctttgcgtaaatca
ATG
BH11840
Gene: BH11840 GI: 49475907 BI number: BH11840 GOG: ------- Description: hypothetical protei
aa ca
a t c a
t c tg
g a cc cg
c A t a cg
g T c t gt
tG g t | g
ta t c | t
tg t t | c
cg cg t t
gc gc ta
ta cg gc
a g gt cg
a c at gc
tg cg ta
gc gc cg
gt gc ta
at at ta
gttttctctataattcaaaccattcatagatgcaagagttgtgggaaaaatcgatgatttctaccgttaagagagaggaaatgttacaagcatggtctagatggacaataaatcaatacgagccggattcaaaatcaaatagtggagacgttatgaaggtggagatcgccttgggtgagatggcagaaggtaatgctttgcgtaaatcaATG
..................................................................................................................