Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance from promoter:190 nt. Distance to gene:36 nt. Distance to run of Ts=0 nt. Size=23 nt. Delta G=-10.40 kcal/mol
Antiterminator: Distance from promoter:158 nt. Size=41 nt. Delta G= -5.24 kcal/mol
Anti-antiterminator: Distance from promoter:124 nt. Size=39 nt. Delta G= -3.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: gtgttt-tatgat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
gtgtttctgaaaatgccaaggtctatgataacactgctataaggtggtgaggtttttagcaaatcatgtatgtatgtccatgccaatgtttatgattatg
cgttgattttaaattatgtacgtatctagataatgctgttattgacgataaagtttggtaagactgagatttaaaaaataaaccttattggaaaaaatat
ccttgtgaaagtctcacaaacgctccaggtgatgcggagcgtttctttctaaaattttctattaaaactttaccaaattataTTG
BH12320
Gene: BH12320 GI: 49475946 BI number: BH12320 GOG: ------- Description: phage related protei
g
a t
a c
at
a gc
t a ta
t a gc
t a ta
a a ta
g a c a
a t c c
g a t g
t a a c g
c a t | t a
a c a | g t
gc a | g g
at a | a c
at a | cg
ta a | cg
gt at ta
g t gc cg
t g gc gc
tg ta cg
ta tg at
ttctttctaaaattttctattaaaactttaccaaattataTTG
..................................................................................................................