Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=28 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-18.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAAAAGCGCGTTCAACACTAGCTGAAGCGATGGCTGCTGTTTCTCGGGTGAATGAGA
GGCGCATTGAGGCCGCGGCCGATATTTGGTTGGCACGGCAAAAAGATCGTGCTCTTTT
ATGTGTACGCTTCGATTTGATCGCCATTTTACCGTGGCGTTGGCCGCAGCATATTCCA
GCATTTTTTATGTCTAATAAATAAgagtttctctatcgttttaaccatggtagatggaaaatatcttgtttatacacatgcg
ttagaaaaagtgcctaataatttgagcgctatgaggagtgaaagATG

    BH12340 --- proC


Gene: BH12340     GI: 49475948     BI number: BH12340     GOG: -------     Description: hypothetical protein
Gene: proC     GI: 49475947     BI number: BH12330     GOG: -------     Description: Pyrroline-5-carboxylate reductas


  A
G  G
T  A
A  G
A  G
 GC
 TG
 GC
G  A
G  T
C  T        T
T  |      T  T
 CG       A  G
 TA        TG
 TG        AT
 TG        GT        AA
 GC        CG       A  A
T  C       CG       A  G
 CG        GC       C  A
 GC       G  A       GT
 TG       C  |       GC
 CG        GC        CG
 GC        CG        AT
 GC        CG        CG
 TG        GC        GC
                        TCTTTTATGTGTACGCTTCGATTTGATCGCCATTTTACCGTGGCGTTGGCCGCAGCATATTCCAGCATTTTTTATGTCTAATAAATAAgagtttctctatcgttttaaccatggtagatggaaaatatcttgtttatacacatgcgttagaaaaagtgcctaataatttgagcgctatgaggagtgaaagATG


    ..................................................................................................................