Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTGTGTAATGGCTTTAATCGCGTCGAGTGCATTTGCTGTTCGCAAGGTGACTTCAA
TTGTTCTTAAGCCTCCTTTGACAAGGGCACGTGCTAAAGGCACGGCATTTTGTAGAGT
ATCAATATGCAAAACAGGTATAATGGTTTGTTCCTGGAGCAGTGATAACAGCTTCTCT
ATTTTTTGGCACATggtgttttttctccaagaaatgatgggtaaggatagtttgattaagcacaatatcttaaagagtaaatgaataagt
cttgaaattgaatgaaacccacgttatgccaaaactATG

    BH12760


Gene: BH12760     GI: 49475975     BI number: BH12760     GOG: COG1054     Description: hypothetical protei


 CT
C  C
 GC
 AT
 AT
|  T
|  G
|  A
|  C
 TA         A
 TA       A  A
 CG       T  G
 TG        CG
 TG        GC
 GC        TA
 TA        GC
T  C       CG
A  G      A  |
 AT        CG
 CG        GC
            ATTTTGTAGAGTATCAATATGCAAAACAGGTATAATGGTTTGTTCCTGGAGCAGTGATAACAGCTTCTCTATTTTTTGGCACATggtgttttttctccaagaaatgatgggtaaggatagtttgattaagcacaatatcttaaagagtaaatgaataagtcttgaaattgaatgaaacccacgttatgccaaaactATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1054 Predicted sulfurtransferase ... can be seen here

    ..................................................................................................................