Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:158 nt.    Distance to gene:4 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.80 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=75 nt.     Delta G= -6.92 kcal/mol
Anti-antiterminator:    Distance from promoter:79 nt.    Size=48 nt.     Delta G= -4.21 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcata-taaaat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcataaaaatacaaagagagtaaaatactctattgatgatactcaaaatatgccttttaccttaaaaggttgctttgataacacataattcagtatgaa
ctgctcatgattttgataagaacaaacagcacacgcatccttttcatatatcatagaaaactatatgaaagaaccaaagtaaacttcttgtctcactgac
tcgagagaggattttttaaaATG

    alr


Gene: alr     GI: 49475978     BI number: BH12810     GOG: COG0787     Description: Alanine racemas


            g
          a  a
          t  a
          a  a
          c  a
          t  c
           at
           ta
           at
           ta
           at
           cg
           ta
           ta
  c        ta
g  a       tg
a  c      |  a
c  a      c  a
a  c      c  c
a  g      t  c
a  c      a  a
c  a      c  a
a  t      g  a
a  c       cg
 gc        at
 at       c  a
 at       a  a       ga
t  t      c  a      t  c
 at        gc       c  t
 gc        at       a  c
 ta       c  t       cg
|  t      a  c       ta
t  a       at        cg
t  t       at        ta
 ta        cg       g  g
 at       a  |       ta
 gc        at        tg
 ta        gc        cg
 at        at        ta
                        ttttttaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0787 Alanine racemase ... can be seen here

    ..................................................................................................................