Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-10.31 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -3.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaaatactaccataaatagctttctgtcctttaaccaaaatactgctaaagagggtatctttagccataaaatccaggaatcatccgtgcatatttcgtg
catgtttattgtgcgatgttaaaatcctttttaacgctgttgttgctcttctgcttttctttgctattatgtccatagaaagccattgcttgagatataa
ggatttgttctttctgtaaaataatcaatttttttagaaacattctaggctatgcaaatttttcacattcgatatttaaaaaagagtacaataaaattcc
ATG

    BH13810


Gene: BH13810     GI: 49476047     BI number: BH13810     GOG: COG0739     Description: hypothetical protei


            g
          g  t
          g  a
           at
           gc
           at
           at
           at
           ta
           cg
           gc
          t  c
          c  a
          a  t
          t  a
          a  a
          a  a
          a  a
          a  t
          c  c
          c  c
 aa       a  |
c  a      a  |
c  a      t  |
a  t      t  |
a  a       ta
t  c       cg
t  t       cg
t  g       ta
c  c      |  a
c  t      |  t        t
t  a      |  c      t  t
g  a      g  a      a  c
 ta       t  t       tg
 cg       c  c       at
 ta       t  c       cg
 tg       t  g       gc
 tg       t  t       ta
 cg        cg        gt
 gt        gc        cg
                        tttattgtgcgatgttaaaatcctttttaacgctgttgttgctcttctgcttttctttgctattatgtccatagaaagccattgcttgagatataaggatttgttctttctgtaaaataatcaatttttttagaaacattctaggctatgcaaatttttcacattcgatatttaaaaaagagtacaataaaattccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0739 Membrane proteins related to metalloendopeptidases ... can be seen here

    ..................................................................................................................