                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.20 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGAAATATCAGCAATGAGCGCTTCCAACATCGCTGAGACATAAGCATCGCCAGAGG
TTTGGCTGCCTGTGACAGAGCGGGCAAAACGTCTAAGATAAGGGAGATGCGGTGCAAT
GCGCGTTGATAATGACATgatttctaactcctttgacatttgaagcactttgttgatcgaaatccttcacagaggaaaaagttcctc
tgttcgtatggaactttttacagataagcatatttacaactataaggcgaaaaattgttctagctgctacttattatatggattaggggggtaaaaaAT
G

    BH13840 --- sigH Gene: BH13840     GI: 49476050     BI number: BH13840     GOG: -------     Description: hypothetical protein Gene: sigH     GI: 49476049     BI number: BH13830     GOG: COG1595     Description: RNA polymerase sigma factor, ecr subfamil   a c  t at gt tg ta ta cg |  c |  a |  c |  t c  t t  t                 aa cg                 a  g at                  at at                  at tg                  gc |  a                 gc |  t                 at |  c                 gc cg                  at ta                  cg ta                  at ta                 |  t at                 |  c gc        ac       |  g T  c      c  a      c  t A  t       tg       t  a C  |       ta       t  t At        cg        cg Gc        cg        cg Ta        ta        ta                         actttttacagataagcatatttacaactataaggcgaaaaattgttctagctgctacttattatatggattaggggggtaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here     ..................................................................................................................