Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggctgttgcgtgggggttgaagcagatgcgcagtgggtgagatgactgtgtggagagcttggagccgatatgggccggggcttttaagacgtctgtctag
aaacttttgagacagatctataggagcttgagggtgtttatgcaatgagaagatcgttcaaagggggaggcaaagatcatcaataaaaataatataaaaa
cacttaataacaaattcactctctgaaaaggaaaaatgtggagtgttaacaaccggcgctttgccgggttttttatgtcaataaacttttagaggataaa
ATG

    BH14010


Gene: BH14010     GI: 49476065     BI number: BH14010     GOG: -------     Description: expressed protei


 tg
c  a
t  a
c  a
 ta
 cg
a  |
 cg
 ta
 ta
|  a
a  a
a  a
 at
 cg
 at
a  g        a
t  |      c  a
a  |      a  c
a  |      a  c        t
 tg        tg       c  t
 ta        tg       g  t
 cg        gc        cg
 at        tg        gc
 cg        gc        gc
 at        at        cg
 at        gt        cg
                        gttttttatgtcaataaacttttagaggataaaATG


    ..................................................................................................................