                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.40 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=15 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcca-tactct. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgccactctttattatgaataatactctcttttttccaattgtttcctttgctgtcatctttcttgcacggttcttcttgtcgttgtttgtttttgatc
ttttttcttctttactcgcgtgatcctcctcttgctatggggcgtgtgagaacccatatttgttttagcactacagctattttcatgctgcctcgttcgc
ggtgttttgcgggggtaaggccgatccttgcgggtgctttggggagttaaagtgcagcggtagtgcaagaaaggaaaaaaaATG

    clpB Gene: clpB     GI: 49476075     BI number: BH14110     GOG: COG0542     Description: ATP-dependent clp protease, ATP-binding subunit clp             t           g  g           t  a           g  g   c       c  a g  t      g  a t  a       gc t  t       gc cg        gc tg        ta cg        at cg        ta             tttgttttagcactacagctattttcatgctgcctcgttcgcggtgttttgcgggggtaaggccgatccttgcgggtgctttggggagttaaagtgcagcggtagtgcaagaaaggaaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0542 ATPases with chaperone activity, ATP-binding subunit ... can be seen here     ..................................................................................................................