                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgagattataaccttgaagttatgacattgcgttagagagatatctatcaacggtgagtatgATGAAAATTAAAAATTCGCTTA
AAGCACTGAGGGAACGCCACCGTAACAATCGTTTGGTGCGTCGCAAAGGTCGTGTTTA
TATCCTCAACAAAACGAACCCACGTTTTAGAGCACGTCAGGGCTGAtggtttttgtgcctgctttt
ttgcaggcattagacctttttggtcttttggaagtttgtttttgcatttctaatcggttggttgatccctcattttttgaggacatgtttttATG

    BH14350 Gene: BH14350     GI: 49476097     BI number: BH14350     GOG: -------     Description: hypothetical signal peptide protei CC A  C A  A GC CG AT AT AT AT C  A A  | A  | C  | T  | C  |       GG C  |      G  C T  |       AT A  |       CG T  |       TA A  |       Gt TG        Cg        tt TA       A  |      t  t TG        Cg       t  t GC        Gt        cg TA        At        gc GC        Gt        ta CG        At        cg T  |      T  t       cg GT       T  g       gc GC       T  t       ta A  A       Tg        gt A  G       Gc       t  t A  G      C  c       ta CG        At        tg GC        Cg        ta                         cctttttggtcttttggaagtttgtttttgcatttctaatcggttggttgatccctcattttttgaggacatgtttttATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-19.10 kcal/mol Antiterminator: Size=41 nt.     Delta G= -8.90 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G= -7.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tgagattataaccttgaagttatgacattgcgttagagagatatctatcaacggtgagtatgATGAAAATTAAAAATTCGCTTA AAGCACTGAGGGAACGCCACCGTAACAATCGTTTGGTGCGTCGCAAAGGTCGTGTTTA TATCCTCAACAAAACGAACCCACGTTTTAGAGCACGTCAGGGCTGAtggtttttgtgcctgctttt ttgcaggcattagacctttttggtcttttggaagtttgtttttgcatttctaatcggttggttgatccctcattttttgaggacatgtttttATG     BH14350 Gene: BH14350     GI: 49476097     BI number: BH14350     GOG: -------     Description: hypothetical signal peptide protei CC A  C A  A GC CG AT AT AT AT C  A       TC A  |      G  A A  |       CG C  |       AG        tt T  |       CG       t  t C  |       GC       t  t C  |       AT        cg T  |      G  |       gc A  |       AG        ta T  |       TA        cg A  |       Tt        cg TG        Tg        gc TA        Tg        ta TG       G  t       gt GC       C  t      t  t TA       A  t      t  | GC        Ct        ta CG        Ct        tg T  |      C  g       ta GT        At        gc GC        Ag        gc                         tttttggtcttttggaagtttgtttttgcatttctaatcggttggttgatccctcattttttgaggacatgtttttATG     ..................................................................................................................