                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:66 nt.    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=33 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtgc-tacagt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtgcattttcgggtgcatgcttacagtttgagattgtatggatgacaaaggataaacagtacaaaacttgagagacgcacggcctttcggggggcgcc
ttttcacatcctttggggtgggaaagtgttcttttgacccgaaaatgagctcttacccccctaaaaaattaaaatttgtttccttaattttatccttttt
agaggataatgcaagtctgttttataaaaaaggacgtgttttttttaaaagacgcgctatatggtgaaactATG

    BH14480 Gene: BH14480     GI: 49476109     BI number: BH14480     GOG: -------     Description: hypothetical protei tc        tt t  g      t  g tg        cg cg        cg cg        tg g  g       at g  |       cg c  |      a  | a  |       cg cg        tg gc        ta cg        ta a  c       ta gc       c  | at        cg gt        gt at        cg gt        gt             tcttttgacccgaaaatgagctcttacccccctaaaaaattaaaatttgtttccttaattttatcctttttagaggataatgcaagtctgttttataaaaaaggacgtgttttttttaaaagacgcgctatatggtgaaactATG     ..................................................................................................................