Gene putatively regulated by attenuation in B_henselae_Houston-1
Characteristics of the secondary structures
Terminator: Distance from promoter:66 nt. Distance to gene:138 nt. Distance to run of Ts=0 nt. Size=34 nt. Delta G=-12.80 kcal/mol
Antiterminator: Distance from promoter:42 nt. Size=33 nt. Delta G= -8.40 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgtgc-tacagt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgtgcattttcgggtgcatgcttacagtttgagattgtatggatgacaaaggataaacagtacaaaacttgagagacgcacggcctttcggggggcgcc
ttttcacatcctttggggtgggaaagtgttcttttgacccgaaaatgagctcttacccccctaaaaaattaaaatttgtttccttaattttatccttttt
agaggataatgcaagtctgttttataaaaaaggacgtgttttttttaaaagacgcgctatatggtgaaactATG

BH14480
Gene: BH14480 GI: 49476109 BI number: BH14480 GOG: ------- Description: hypothetical protei
tc tt
t g t g
tg cg
cg cg
cg tg
g g at
g | cg
c | a |
a | cg
cg tg
gc ta
cg ta
a c ta
gc c |
at cg
gt gt
at cg
gt gt
tcttttgacccgaaaatgagctcttacccccctaaaaaattaaaatttgtttccttaattttatcctttttagaggataatgcaagtctgttttataaaaaaggacgtgttttttttaaaagacgcgctatatggtgaaactATG
..................................................................................................................