                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGTCGCCCAATATAAGAACTCGAAAGCGGGTTTTTCGCTTCTTCTATGCTTAAACC
AAAATGTTTCGCACGCATTTCAATCGTAACTTGTGGAACAGCCTTGTTTGGTCTTTTT
GCACGTGAAATACGGCCATTGGGTTCTCTTGGTTTGCCTGTTATTCTAGGTCTACCGC
GTTTTTTAACTGTTTTCATGAATTTACCGTTTGAAGTAAAAAAGAACTCTCTCGCTAA
CGATGACAGCATggggaaaattctctcagtcatgcttttatggggaggcgcctatcggtgggagggcgATG

    BH14570 Gene: BH14570     GI: 49476118     BI number: BH14570     GOG: -------     Description: hypothetical protei AC C  G GT TG TA TA TA        TC |  T      T  T |  A       GC T  C       GT CG       G  T       AT TG       T  G      T  T GC        TG       T  C GC        AT        GT TA       |  T       TA T  T      C  T       CG T  T       CG        CG G  |       GC        GT T  |       GC       T  C TG       C  |      T  T CG        AT        TA CG        TG        GC GT        AT        GC AT        AT        TG                         CGTTTTTTAACTGTTTTCATGAATTTACCGTTTGAAGTAAAAAAGAACTCTCTCGCTAACGATGACAGCATggggaaaattctctcagtcatgcttttatggggaggcgcctatcggtgggagggcgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:119 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -8.60 kcal/mol Antiterminator: Size=34 nt.     Delta G= -7.10 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-10.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAGTCGCCCAATATAAGAACTCGAAAGCGGGTTTTTCGCTTCTTCTATGCTTAAACC AAAATGTTTCGCACGCATTTCAATCGTAACTTGTGGAACAGCCTTGTTTGGTCTTTTT GCACGTGAAATACGGCCATTGGGTTCTCTTGGTTTGCCTGTTATTCTAGGTCTACCGC GTTTTTTAACTGTTTTCATGAATTTACCGTTTGAAGTAAAAAAGAACTCTCTCGCTAA CGATGACAGCATggggaaaattctctcagtcatgcttttatggggaggcgcctatcggtgggagggcgATG     BH14570 Gene: BH14570     GI: 49476118     BI number: BH14570     GOG: -------     Description: hypothetical protei GT T  T T  T CG CG GT A  C C  T AT AT GT G  T T  G       TA GC       A  C TA        AG T  |       AG C  |      G  C       AT A  |      T  C      T  T A  |       GA       T  C T  |       CT        GT GC       |  T       TA CG       A  G       CG T  |       CG        CG A  |       GG        GT AT        TT       T  C CG       T  |      T  T TA        TT        TA TA        TC        GC TA        TT        GC AT        CC        TG                         CGTTTTTTAACTGTTTTCATGAATTTACCGTTTGAAGTAAAAAAGAACTCTCTCGCTAACGATGACAGCATggggaaaattctctcagtcatgcttttatggggaggcgcctatcggtgggagggcgATG     ..................................................................................................................