                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=59 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gagatattcaaagcagggataactaaatttgtaaaaaattcgtgtttatctttgggaaacagtacgagacctttgacgtaaggataaaattatattagat
taaaacgagttttgcggcttcatgcttgtagaacaatcggttttttttatgcgcgacctttaatccgttatttgagacaaccgacctgtaatattggtgc
ttcgaggtgccaaaagtagaaatgatagtgtgcttggtcattttgtgtggggccttttgttcataatgcggttgcagtaaaaaccaggtcaggatatttt
ATG

    sdhC --- sdhD --- sdhA --- sdhB Gene: sdhC     GI: 49476235     BI number: BH15800     GOG: -------     Description: Succinate dehydrogenase cytochrome b560 subunit Gene: sdhD     GI: 49476234     BI number: BH15790     GOG: -------     Description: Succinate dehydrogenase hydrophobic membrane anchor protein Gene: sdhA     GI: 49476233     BI number: BH15780     GOG: COG1053     Description: Succinate dehydrogenase, flavoprotein subunit Gene: sdhB     GI: 49476232     BI number: BH15770     GOG: COG0479     Description: Succinate dehydrogenase, iron-sulfur protei at a  t a  a at ta at gt |  a |  g g  a at at ta g  a        c c  a      t  a a  a      t  t gc        cg tg        gc ta       |  t t  |       gt c  |       cg cg        gt at        ta gt        tg at        ta gt        ta cg        gc |  c      |  a a  g      |  a tg        at gc        gc at        cg             gttttttttatgcgcgacctttaatccgttatttgagacaaccgacctgtaatattggtgcttcgaggtgccaaaagtagaaatgatagtgtgcttggtcattttgtgtggggccttttgttcataatgcggttgcagtaaaaaccaggtcaggatattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1053 Succinate dehydrogenase/fumarate reductase, flavoprotein subunit ... can be seen here [C] COG0479 Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit ... can be seen here     ..................................................................................................................