                                                                        Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACATTGATTTCTGAAGTGTTACAGCAAAGTTACCGTTTGCGCGTTTCGGCAAGCGCT
TTACGTTCTGTTGAGCACCGCGGTGGTCTTGATGGATTTTTGGTTAAAGCCGATGATA
AAGAATTATCGCAACGTGCCCGTTTGTTAAAGCGCCAGATTGTTAAGAAAAAAGCTGA
AAAAGCGGCGTAAtcgcctttgtttattgcagggctggattgtgtgctctcattatagagggcagtgtttttggttttttactttttgatc
gctgtattaaatggttccataccctaggttaaaagATG

    BH15910 Gene: BH15910     GI: 49476245     BI number: BH15910     GOG: COG1738     Description: Transmembrane protei AA A  A A  G GC TG CG GC A  G A  | A  |        a A  |      t  t A  |      t  t A  |       tg G  |       gc A  |      t  | A  |       ta T  |       tg T  |       cg GT        cg TA        gc TA       |  t At       |  g Gc        cg A  |       ta        ta C  |       At       t  t Cg        At       a  a Gc        Tg        cg C  |      |  t       ta Gc       |  g       cg At        Gt        tg At        Cg        cg At        Gc        gc Tg        Gt        ta                         gtgtttttggttttttactttttgatcgctgtattaaatggttccataccctaggttaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:46 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -9.20 kcal/mol Antiterminator: Size=42 nt.     Delta G=-10.60 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -7.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACATTGATTTCTGAAGTGTTACAGCAAAGTTACCGTTTGCGCGTTTCGGCAAGCGCT TTACGTTCTGTTGAGCACCGCGGTGGTCTTGATGGATTTTTGGTTAAAGCCGATGATA AAGAATTATCGCAACGTGCCCGTTTGTTAAAGCGCCAGATTGTTAAGAAAAAAGCTGA AAAAGCGGCGTAAtcgcctttgtttattgcagggctggattgtgtgctctcattatagagggcagtgtttttggttttttactttttgatc gctgtattaaatggttccataccctaggttaaaagATG     BH15910 Gene: BH15910     GI: 49476245     BI number: BH15910     GOG: COG1738     Description: Transmembrane protei AA A  A A  G GC TG CG GC A  G A  | A  |        t A  |      t  a A  |      t  t A  |       gt G  |       tg A  |      t  | A  |       tc T  |       ca T  |       cg GT        gg TA        cg TA       |  c At       |  t Gc        tg A  |       Ag        ta C  |       Aa       t  t Cg        Tt       a  a Gc        Gt        cg C  |      |  g       ta Gc       |  t       cg At        Cg        tg At        Gt        cg At        Gg        gc Tg        Cc        ta                         gtgtttttggttttttactttttgatcgctgtattaaatggttccataccctaggttaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_henselae_Houston-1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:54 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -9.20 kcal/mol Antiterminator: Size=42 nt.     Delta G=-10.60 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -7.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACATTGATTTCTGAAGTGTTACAGCAAAGTTACCGTTTGCGCGTTTCGGCAAGCGCT TTACGTTCTGTTGAGCACCGCGGTGGTCTTGATGGATTTTTGGTTAAAGCCGATGATA AAGAATTATCGCAACGTGCCCGTTTGTTAAAGCGCCAGATTGTTAAGAAAAAAGCTGA AAAAGCGGCGTAAtcgcctttgtttattgcagggctggattgtgtgctctcattatagagggcagtgtttttggttttttactttttgatc gctgtattaaatggttccataccctaggttaaaagATG     BH15910 Gene: BH15910     GI: 49476245     BI number: BH15910     GOG: COG1738     Description: Transmembrane protei GA T  A C  A GA AA AG AC A  G A  | A  |        t G  |      t  a A  |      t  t A  |       gt T  |       tg T  |      t  | G  |       tc T  |       ca T  |       cg AG        gg GC        cg AG       |  c CT       |  t CA        tg G  |       Ag        ta C  |       Aa       t  t GA        Tt       a  a At        Gt        cg A  |      |  g       ta Ac       |  t       cg Tg        Cg        tg Tc        Gt        cg Gc        Gg        gc Tt        Cc        ta                         gtgtttttggttttttactttttgatcgctgtattaaatggttccataccctaggttaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................