Gene putatively regulated by attenuation in B_henselae_Houston-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAGGCTGGTGCTTACGGTGCTGTGATGGCAAGCACTTATAATAGCCGACTTTTGGT
GCCAGAAGTTCTCGTTCAGGATACGCGTTATGCGGTTATTCGTCCACGTCTTGATTAT
GCACAATTGATAGGCTGTGATTATGTTCCAGATTGGATTTGAgttcagatgagattgaacattgttcaa
tgtttttggtcttatttttactaaactttgatgaaacaatttatttcctggaaattgtcttgtatgaattttataattgtaattcatcactctaaaaggg
gacaaatatttgtctATG

    BH16160


Gene: BH16160     GI: 49476268     BI number: BH16160     GOG: NOG14524     Description: hypothetical protei


 AT
G  A
T  G       gt
T  G      A  t
A  C       Gc
 AT        Ta
 CG        Tg
 AT        Ta
 CG        At
|  A      G  g       tt
|  T      G  a      g  c
 GT        Tg        ta
 TA        Ta        ta
 AT        At        at
 TG        Gt        cg
T  T      A  |       at
 AT       C  |       at
 GC        Cg        gt
T  C       Ta       |  t
 TA        Ta       |  t
 CG        Gc        tg
 TA        Ta        tg
 GT        At        at
C  |      T  t       gc
 AT        Tg        at
 CG        At        gt
 CG        Gt        ta
                        tttttactaaactttgatgaaacaatttatttcctggaaattgtcttgtatgaattttataattgtaattcatcactctaaaaggggacaaatatttgtctATG


    ..................................................................................................................